ID: 903279948_903279959

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 903279948 903279959
Species Human (GRCh38) Human (GRCh38)
Location 1:22244768-22244790 1:22244806-22244828
Sequence CCTTTGCTGCTGTGATCGCCTCT AACCAGGGGAGAAGGTGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 28, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!