ID: 903682740_903682750

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903682740 903682750
Species Human (GRCh38) Human (GRCh38)
Location 1:25108005-25108027 1:25108057-25108079
Sequence CCAGCTGCAGGGCTATGATTGGG CAGGTGATGGGACTTGTCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 17, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!