ID: 903909140_903909149

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 903909140 903909149
Species Human (GRCh38) Human (GRCh38)
Location 1:26709464-26709486 1:26709493-26709515
Sequence CCATGGAAGTTCTCAACAGCACC CCAGGACCCCAGGTTCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136} {0: 1, 1: 0, 2: 6, 3: 29, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!