ID: 903953299_903953305

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 903953299 903953305
Species Human (GRCh38) Human (GRCh38)
Location 1:27008966-27008988 1:27009017-27009039
Sequence CCTCCATCCTTCTTTTTTTTTTT CCTGATTTTGTAGCTGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 780, 3: 5220, 4: 25278} {0: 1, 1: 0, 2: 0, 3: 11, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!