ID: 904026099_904026110

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904026099 904026110
Species Human (GRCh38) Human (GRCh38)
Location 1:27504693-27504715 1:27504711-27504733
Sequence CCTGCTTCCCTCTGGTGAGAATG GAATGGGGAGGAGGGAGGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!