ID: 904271775_904271780

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 904271775 904271780
Species Human (GRCh38) Human (GRCh38)
Location 1:29354887-29354909 1:29354908-29354930
Sequence CCTTGGCACAGCCCTCGTGGTCC CCCGCCTGACCCAGTCCTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!