ID: 904528614_904528618

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904528614 904528618
Species Human (GRCh38) Human (GRCh38)
Location 1:31154008-31154030 1:31154039-31154061
Sequence CCTCCGTCTCCTGGATTCAAGTG GTCTCAGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} {0: 5482, 1: 97792, 2: 202426, 3: 230698, 4: 150991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!