ID: 904775078_904775095

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904775078 904775095
Species Human (GRCh38) Human (GRCh38)
Location 1:32901412-32901434 1:32901447-32901469
Sequence CCGTCACCCCCCGGGCCGCCCGG CCCGCGGCTCGTGCCCCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 405} {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!