ID: 904775081_904775100

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 904775081 904775100
Species Human (GRCh38) Human (GRCh38)
Location 1:32901419-32901441 1:32901460-32901482
Sequence CCCCCGGGCCGCCCGGCCCCGCA CCCCTCCCGGCCGGTCGGACCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 56, 4: 566} {0: 1, 1: 0, 2: 1, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!