ID: 904786690_904786692

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 904786690 904786692
Species Human (GRCh38) Human (GRCh38)
Location 1:32988214-32988236 1:32988251-32988273
Sequence CCAGGCTCCAGCTATGTATACAA TTGTTTTTGTTTTTTGAGACAGG
Strand - +
Off-target summary No data {0: 181, 1: 566, 2: 16722, 3: 24611, 4: 39755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!