ID: 904822826_904822839

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 904822826 904822839
Species Human (GRCh38) Human (GRCh38)
Location 1:33256450-33256472 1:33256493-33256515
Sequence CCCGCCGCCGCCGCCGCCGCCGC GAAGTGAACAGCAGGCGACCCGG
Strand - +
Off-target summary {0: 182, 1: 288, 2: 633, 3: 1353, 4: 3315} {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!