ID: 905044452_905044458

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 905044452 905044458
Species Human (GRCh38) Human (GRCh38)
Location 1:34985045-34985067 1:34985076-34985098
Sequence CCTGCGCCTCAGTCGAAAGCCAG CCCCAGCTCCAGCTGAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51} {0: 1, 1: 0, 2: 6, 3: 66, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!