ID: 905152698_905152705

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 905152698 905152705
Species Human (GRCh38) Human (GRCh38)
Location 1:35944290-35944312 1:35944325-35944347
Sequence CCTAAGCTCCTAAGCCTCCTGAG CAGGCACAAGATGCTGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 256} {0: 1, 1: 0, 2: 19, 3: 273, 4: 2353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!