|
Left Crispr |
Right Crispr |
| Crispr ID |
905152702 |
905152705 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:35944304-35944326
|
1:35944325-35944347
|
| Sequence |
CCTCCTGAGTGTCTGGGATTACA |
CAGGCACAAGATGCTGTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 30, 1: 1660, 2: 61088, 3: 150861, 4: 238929} |
{0: 1, 1: 0, 2: 19, 3: 273, 4: 2353} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|