|
Left Crispr |
Right Crispr |
| Crispr ID |
905152704 |
905152705 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:35944307-35944329
|
1:35944325-35944347
|
| Sequence |
CCTGAGTGTCTGGGATTACAGGC |
CAGGCACAAGATGCTGTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 32, 1: 2185, 2: 82344, 3: 217868, 4: 249848} |
{0: 1, 1: 0, 2: 19, 3: 273, 4: 2353} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|