ID: 905339029_905339038

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 905339029 905339038
Species Human (GRCh38) Human (GRCh38)
Location 1:37265789-37265811 1:37265805-37265827
Sequence CCCAAGGCCAAGGCTCGGGGCAG GGGGCAGGAAAGGGGGCATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 47, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!