ID: 905339033_905339043

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 905339033 905339043
Species Human (GRCh38) Human (GRCh38)
Location 1:37265796-37265818 1:37265840-37265862
Sequence CCAAGGCTCGGGGCAGGAAAGGG CCTAAAAGCCTCCTGAAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!