ID: 905397260_905397268

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 905397260 905397268
Species Human (GRCh38) Human (GRCh38)
Location 1:37674730-37674752 1:37674761-37674783
Sequence CCTTCTCCACGCCATGCAGCTGC CTGCACCATTTCTACCACTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!