ID: 905493384_905493390

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 905493384 905493390
Species Human (GRCh38) Human (GRCh38)
Location 1:38362885-38362907 1:38362898-38362920
Sequence CCACTGGGTCCCTCTCATGACAC CTCATGACACATGGGGATTATGG
Strand - +
Off-target summary {0: 38, 1: 405, 2: 1223, 3: 3076, 4: 5066} {0: 38, 1: 520, 2: 1401, 3: 2689, 4: 4142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!