ID: 905493388_905493392

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 905493388 905493392
Species Human (GRCh38) Human (GRCh38)
Location 1:38362894-38362916 1:38362925-38362947
Sequence CCCTCTCATGACACATGGGGATT TACAATTCAAGATGAGATTTGGG
Strand - +
Off-target summary {0: 42, 1: 588, 2: 1500, 3: 3288, 4: 5874} {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!