ID: 905664270_905664276

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 905664270 905664276
Species Human (GRCh38) Human (GRCh38)
Location 1:39753147-39753169 1:39753171-39753193
Sequence CCAGGGGCTGTGTCCAGCGGGAG GGCTGCTGCTGCCCAGGTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 10, 4: 248} {0: 1, 1: 0, 2: 2, 3: 48, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!