ID: 905851765_905851772

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 905851765 905851772
Species Human (GRCh38) Human (GRCh38)
Location 1:41280024-41280046 1:41280052-41280074
Sequence CCACAGGGAACCCCCTTCTCCTG GCCCCTGACCTCCAGCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!