ID: 905938097_905938107

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 905938097 905938107
Species Human (GRCh38) Human (GRCh38)
Location 1:41840720-41840742 1:41840766-41840788
Sequence CCCATCAGATCCTGGCCGTGCCA AACCAGAGGAAGCTTGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83} {0: 1, 1: 0, 2: 0, 3: 17, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!