ID: 905938097_905938109

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 905938097 905938109
Species Human (GRCh38) Human (GRCh38)
Location 1:41840720-41840742 1:41840770-41840792
Sequence CCCATCAGATCCTGGCCGTGCCA AGAGGAAGCTTGGCACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83} {0: 1, 1: 0, 2: 1, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!