ID: 905974779_905974784

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905974779 905974784
Species Human (GRCh38) Human (GRCh38)
Location 1:42166206-42166228 1:42166253-42166275
Sequence CCCTGATGGGTGTGTGTAGCCAA CTGAAGGTGTGTGTGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119} {0: 1, 1: 4, 2: 17, 3: 89, 4: 786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!