ID: 906026430_906026434

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 906026430 906026434
Species Human (GRCh38) Human (GRCh38)
Location 1:42678054-42678076 1:42678097-42678119
Sequence CCTACAGTACAGACATTTGCAAC TCAGAGGACATTGTAGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 25, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!