ID: 906133316_906133326

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 906133316 906133326
Species Human (GRCh38) Human (GRCh38)
Location 1:43475665-43475687 1:43475696-43475718
Sequence CCTTCCTCCCCTTTCGCTTTCCT CCCCGCATGGTCTATGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 197, 4: 1886} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!