ID: 906256681_906256689

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 906256681 906256689
Species Human (GRCh38) Human (GRCh38)
Location 1:44355737-44355759 1:44355789-44355811
Sequence CCTGGGGGAGACCTGAGACAAGG ATTTGTGAAGGGCCGTCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 186} {0: 1, 1: 0, 2: 1, 3: 8, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!