ID: 906583403_906583406

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 906583403 906583406
Species Human (GRCh38) Human (GRCh38)
Location 1:46955070-46955092 1:46955104-46955126
Sequence CCACTGTAACACAGAGAAAGGAA TGCCTTTCTGCAGAAACTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 62, 3: 66, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!