ID: 906678708_906678718

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 906678708 906678718
Species Human (GRCh38) Human (GRCh38)
Location 1:47710642-47710664 1:47710678-47710700
Sequence CCGGGGCTCGCTGCAGGCCCATG TTCGTGGCCGGAGGCGCAGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!