ID: 906719699_906719707

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 906719699 906719707
Species Human (GRCh38) Human (GRCh38)
Location 1:47996566-47996588 1:47996581-47996603
Sequence CCCGGGGGGTGGAGGTGGAGCGG TGGAGCGGGCGGGCTAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 96, 4: 915} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!