ID: 906794890_906794900

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 906794890 906794900
Species Human (GRCh38) Human (GRCh38)
Location 1:48689008-48689030 1:48689059-48689081
Sequence CCCCATTCAGAAAGAAGATCCAT TACAAAACTTAGCTGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 241} {0: 2, 1: 11, 2: 139, 3: 894, 4: 1847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!