|
Left Crispr |
Right Crispr |
Crispr ID |
906794894 |
906794900 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:48689027-48689049
|
1:48689059-48689081
|
Sequence |
CCATTGTGGTGAAACCCCGTCTC |
TACAAAACTTAGCTGGGCTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 735, 2: 8309, 3: 59678, 4: 145711} |
{0: 2, 1: 11, 2: 139, 3: 894, 4: 1847} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|