ID: 906837621_906837627

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 906837621 906837627
Species Human (GRCh38) Human (GRCh38)
Location 1:49100893-49100915 1:49100943-49100965
Sequence CCATGCTGCAGATAAGGATGCTG TTAATCAGTAAATGGTAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 483} {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!