ID: 906877110_906877116

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 906877110 906877116
Species Human (GRCh38) Human (GRCh38)
Location 1:49551680-49551702 1:49551717-49551739
Sequence CCTGTTCCAGTGGAGGTGATAGC TCCATGAGAGTTCTTAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 88, 4: 269} {0: 6, 1: 31, 2: 91, 3: 158, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!