ID: 907268046_907268053

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 907268046 907268053
Species Human (GRCh38) Human (GRCh38)
Location 1:53274738-53274760 1:53274780-53274802
Sequence CCTCTGCACATCACACACTTTCC ACTCTTACACTGAAATCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 311} {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!