ID: 907268049_907268060

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 907268049 907268060
Species Human (GRCh38) Human (GRCh38)
Location 1:53274763-53274785 1:53274806-53274828
Sequence CCGTCCACGCGCTTGCCACTCTT CCTCACAGGGTGACTCTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 0, 2: 0, 3: 26, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!