ID: 907692892_907692901

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 907692892 907692901
Species Human (GRCh38) Human (GRCh38)
Location 1:56688207-56688229 1:56688220-56688242
Sequence CCTACCCCATTGTGGTTAGGGGT GGTTAGGGGTGGGGGACAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 90, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!