ID: 907714349_907714354

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 907714349 907714354
Species Human (GRCh38) Human (GRCh38)
Location 1:56913621-56913643 1:56913647-56913669
Sequence CCAATTCCTAAGCTCCCACTTTT GGCACATAAAACTGTTTGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 831} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!