ID: 907747520_907747522

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 907747520 907747522
Species Human (GRCh38) Human (GRCh38)
Location 1:57228075-57228097 1:57228091-57228113
Sequence CCTTTTCCTCTATCAACAGACTG CAGACTGAAGTGCCTATAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 213} {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!