ID: 907806289_907806292

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 907806289 907806292
Species Human (GRCh38) Human (GRCh38)
Location 1:57823683-57823705 1:57823704-57823726
Sequence CCAGGGATTGATGTATAAAAGGA GAAAGTGGCCCTGACATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!