ID: 907820897_907820901

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 907820897 907820901
Species Human (GRCh38) Human (GRCh38)
Location 1:57967370-57967392 1:57967407-57967429
Sequence CCTGAACTGTACTTGCTACCCAC TGAACATCATCATAATACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!