ID: 907960349_907960355

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 907960349 907960355
Species Human (GRCh38) Human (GRCh38)
Location 1:59274069-59274091 1:59274102-59274124
Sequence CCAAATGCCTCATGTTCTCACTT GCTAAGCTATGGGCACGTAAAGG
Strand - +
Off-target summary {0: 11, 1: 249, 2: 2263, 3: 6666, 4: 19256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!