ID: 907960350_907960355

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 907960350 907960355
Species Human (GRCh38) Human (GRCh38)
Location 1:59274076-59274098 1:59274102-59274124
Sequence CCTCATGTTCTCACTTATATGTG GCTAAGCTATGGGCACGTAAAGG
Strand - +
Off-target summary {0: 77, 1: 2723, 2: 16315, 3: 17755, 4: 6561} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!