ID: 908077346_908077357

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 908077346 908077357
Species Human (GRCh38) Human (GRCh38)
Location 1:60535161-60535183 1:60535214-60535236
Sequence CCAACATCACTCCTCTGTAGGCC GCTGGGCTCCTTAGTAACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!