ID: 908258034_908258041

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 908258034 908258041
Species Human (GRCh38) Human (GRCh38)
Location 1:62318693-62318715 1:62318707-62318729
Sequence CCCAGACCGCAGCGCCTAGCTCG CCTAGCTCGGAAAAGCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!