ID: 908353813_908353821

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 908353813 908353821
Species Human (GRCh38) Human (GRCh38)
Location 1:63312288-63312310 1:63312314-63312336
Sequence CCTCCGGGGTCCCGGTGATTCTC CCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary No data {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!