ID: 908353813_908353822

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 908353813 908353822
Species Human (GRCh38) Human (GRCh38)
Location 1:63312288-63312310 1:63312315-63312337
Sequence CCTCCGGGGTCCCGGTGATTCTC CTCAGCCTCCTGAGTAGCTGGGG
Strand - +
Off-target summary No data {0: 2097, 1: 4231, 2: 5385, 3: 4345, 4: 3316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!