ID: 908436337_908436344

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 908436337 908436344
Species Human (GRCh38) Human (GRCh38)
Location 1:64110517-64110539 1:64110552-64110574
Sequence CCATCCTCATCTTTCTTCTGCTT AAAAACAGGATAACAAAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 74, 4: 917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!