ID: 908445441_908445445

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 908445441 908445445
Species Human (GRCh38) Human (GRCh38)
Location 1:64195556-64195578 1:64195581-64195603
Sequence CCTTACACGGAATCCCTCTCATG TTGAGTCACTGACTTCAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!